Introduction of research Paper Example | Topics and Well Written Essays - 750 words

Introduction of - Research Paper Example The paper is going to examine and discuss the function of aniline substituents by looking into the intensities of SERS of different anilines in gold and silver colloids by utilizing a Raman spectrometer which has a 785 nm excitation wavelength. The Chemical Enhancement factors of the Surface Enhanced Raman and detection limits for aniline and its mono- and di-substituted meta derivatives are established and comparisons made. The inductive impacts of withdrawal of electrons as a result of substituents and the steric needs of chemical adsorption influence the strength of signals of different vibrational modes of the aromatic ring and amino group. By utilizing the transmission electron microscopy (TEM), the level of improvement is also linked to the ways of setting up the silver and gold colloids, which are characterized by exploring the structural morphology of the nanoparticle and its level of aggregation. Introduction: What is Raman Effect? Raman scattering or Raman Effect is the ine lastic scattering of photons from an atom or a molecule (Sur, 2010). It was discovered by a well known Indian physicist C V Raman in the year 1928. Generally, most photons are elastically scattered from an atom or a molecule, with the scattered photons having the same energy and wavelength as the incident photons (Sur, 2010). This phenomenon is known as ‘Rayleigh scattering’ and it accounts for the blue color of the sky (Sur, 2010). There is however a difference in frequency between the scattered photons and the incident photons. This physicist discovered the Raman Effect as he was working on the molecular diffraction of light and observed this effect in liquid. The Other Russian scientists Gregory Landsberg and Leonid Mandelstam first observed this effect in crystals (Sur, 2010). Raman won the Nobel Prize in 1930 for his work on inelastic scattering of photons. The history of SERS SERS was discovered accidentally in 1974 as people attempted to perform Raman on the elec trode with an original idea of generating a high surface area on that extremely roughened metal. With time, people realized that the surface area was not the fundamental point on this arena. Periodical searches were made in the dark, which led to progress in 1977 when different groups found out that the rough silver electrode can produce a Raman spectrum that is a million fold more intense than what was expected (Ferraro, 1994). The huge signal confirmed surface enhanced Raman scattering (SERS). SERS have recently overcome the disadvantage of the small cross section of Raman spectroscopy completely, and therefore can be utilized to study the single molecule spectroscopy (Ferraro, 1994). Surface-enhanced Raman spectroscopy (SERS) has experienced renaissance recently in its development as a result of the remarkable discovery of single molecule SERS (SMSERS). This has also led to the explosion of interest in nanophotonics and plasmonics (Dieringer, 2005). Since excitation of the locali zed surface Plasmon resonance (LSPR) of a nanostructured surface or nanoparticle Is centered at the heart of SERS, it is vital to have in control all of the factors influencing the LSPR with an aim to maximize signal strength and ensure reproducibility (Dieringer, 2005)

Enjoyable Theatrical Experience Essay Example for Free

Enjoyable Theatrical Experience Essay An Inspector Calls was written by J. B Priestley in 1945. The play is set in 1912. In England this was a time of strikes, riots and poverty. The play was partly written by Priestley to highlight a number of very important issues in our lives, which include social class, capitalist and social attitude to life, equality, prejudice, wealth, poverty, rights and responsibilities. It is for this reason that the play may be described as an effective piece of social criticism. It criticises the way in which some people live and think, as well as make us question what is right and what is wrong. The play is a very enjoyable theatrical experience as it is full of excitement, suspense, tension and dramatic irony. In this offer my own opinions and support these with evidence, quotations and examples. It is important to understand what the terms capitalist and socialist mean. Capitalists are people who have power and money. They show their status and wealth. They only care about themselves and dont care anybody else. Socialists are people who care about everybody not just themselves. They are unselfish and believe in welfare of others. Above all Priestley uses one of the main characters, Inspector Goole as a strong mouthpiece to represent his own values, morals and beliefs and sends this message to his audience. The message is that people should not be split into different classes or treated differently as all people are off equal importance and have rights and responsibilities, regardless of the amount of money that they have. Priestley uses Inspector Goole to convey this message, stating in act three, page 56 that:- We are responsible of each other. And I tell you that the time will soon come when, if men will not learn this lesson, then they will be taught it in fire and blood and anguish. This is exactly what happened because in 1914, two years after the play was set, First World War started, this was the result of assassination of Austro-Hungarian heir to throne in Sarajevo by a Serbian student. Income tax doubled to pay for the war which was costing i 1million daily. Priestley wants the world to be full of peace, love and forgiveness. Priestley shows that the Birling family are capitalists and have great wealth in a number of ways. For example their house is described as The dining-room of a fairly large suburban house, belonging to a prosperous manufacturer. It has good solid furniture of the period. The general effect is substantial and heavily comfortable, but not Cosy and homelike. This is evidenced in act one, page 1 at the start of the play. They also have a made called Edna. This shows that they belong to a wealthy family and they can afford a maid.

Mineral Resource in Ecofriendly Invertebrate Powder

Mineral Resource in Ecofriendly Invertebrate Powder A SEARCH OF BIO MACRO AND MICRO MINERAL RESOURCE IN ECOFRIENDLY INVERTEBRATE POWDER: Eudrilus eugeniae J. Anitha, R. Selvakumar  and Indira A. Jayraaj Abstract Quantification of macro and micro nutrients from earthworm (Eudrilus eugeniae) was aimed and successfully elucidated in the present study. Macro minerals like calcium, magnesium, phosphorous, potassium, nitrogen and sodium and micro or trace elements like iron, selenium, zinc, copper, sulphur, Nickel, Chromium and molybdenum was assayed using colorimeter, Micro-Kjeldahl method, flame photometer, EDTA Titrimetric method and specifically atomic absorption spectrophotometer (AAS). From the study, it is evident that the earthworm powder of E. eugeniae is a rich source of macrominerals (Calcium and Magnesium) and trace elements (Iron and selenium) together with notable quantities of other important elements, indicating that this earthworm contain potentially useful quantities of many nutrients that are critical to the health of the humans and animals who consume them. Keywords: AAS, Earthworm powder, Eudrilus eugeniae, Metals, Macro minerals. Introduction Metals are nutrients in soil are absorbed by plants, transferred to animals and men by food chains, and finally return to the soil. Earthworms are found virtually worldwide and live in almost any type of soil that contains the right amounts of moisture and organic particles and of various sizes and colors [1]. It has dense nutritional content because of their soil based origin [2]. The earthworm is a widely used Chinese herbal medicine [3]. Although Wallace [4;5] reported more than 100 years ago the inclusion of earthworms in diets of Amerindian tribal) populations little is known about the nutritive value of those edible invertebrates [6]. Extracting medicinal compounds from the earthworm has traditionally been practiced by indigenous people throughout the world, more particularly in Asia [7]. Previous earthworm studies have shown its antimicrobial [3] hepatoprotective [4], anticancer [8] and scar wound healing characteristics [9]. The anti-inflammatory activity together with antiox idant properties seems to be due to the high polyphenolic content in earthworm tissue [10]. Moreover, crude earthworm extract has a thrombolytic effect that could significantly promote blood circulation to remove stasis [11]. Minerals are the nutrients that exist in the body, and are as essential as our need for oxygen to sustain life. Minerals are also found in organic and inorganic combinations in food. It plays a vital role for all mental and physical processes including for total well being. They are most important factors in maintaining all physiological processes, are constituents of the teeth, bones, tissues, blood, muscle, and nerve cells [12]. Therefore, since the drive of animal farmers worldwide is to source for cheaper means of nutritive dietary supplement which may replace fishmeal wholly or partly in animal diet and also supply micro and macro-nutrients [13]. Considering the above facts the present study was aimed to quantify macro and micro or trace mineral profile of earthworm species Eudrilus eugeniae. Materials and methods Collection of earthworm The earthworm Eudrilus eugeniae was collected from Aarthi farms, Kondegoundanpalayam village, Pollachi Taluk, Coimbatore District, Tamil Nadu, India. The collected species were cultured under optimal conditions in compost yard at Kongunadu Arts and Science College Premises, Coimbatore 641 029, Tamil Nadu, India, for further use. Processing of earthworm The earthworms were washed with running tap water to remove any dirt from body surface. The earthworms were kept in 0.5% NaCl at room temperature for 1-2h with few changes of solution until their digestive systems were clean. Cleaned earthworms are taken and dried at 65-800C in forced draught, stainless-steel lined ovens. Ground the samples completely to a particle size of less than 1mm, and mixed thoroughly before a sub sample of suitable size is stored for analysis. Store the samples in a clearly labelled, airtight, glass or polycarbonate containers to prevent samples from contamination. Storage at room temperature is sufficient, but long term storage of reference material requires freezing. Re-dry the samples at 650C for 12 hours prior to weighing for heavy metal analysis. Digestion of earthworm Weigh 0.5 1 g sample accurately into acid washed 250 ml digest tubes. Add 6 10 ml concentrated HNO3, swirl to mix sample and acid. Place tubes onto a Tecator 40 system, or similar set at 1000C for 2 hours. Reduce the total volume to 1 ml. The sample solution becomes thick slurry. Remove samples from digestion block; allow cooling and diluting to 10 or 20 ml with deionized water. Allow samples to settle (minimum 2 hours, preferably overnight), and filter through Whatman No. 40 filter paper or centrifuge at 6000 rpm for 15 minutes. Run at least two digest blanks with samples. The schematic representation of analytical procedure of minerals is given in figure1. Figure 1. Schematic diagram of the micro and macro nutrient analytical procedure Method of mineral analysis The processed earthworm powder was subjected to quantification of macro minerals (calcium, magnesium, phosphorous, potassium, nitrogen and sodium) and micro or trace elements (iron, selenium, zinc, copper, sulphur, nickel, chromium and molybdenum) using the methods of Jackson [14] for spectrophotometer (Perkin elmer Lamada EZ201), flame photometer (Cole-Parmer, 500731), EDTA Titrimetric and specifically atomic absorption spectrophotometer (Hitachi Z9000) [15;16]. Results The selected earthworm species, E. eugeniae was successfully converted into powdered and subjected to mineral analysis in that six macro minerals namely calcium, magnesium, nitrogen, phosphorus, potassium, and sodium and eight trace elements like iron selenium, zinc, copper, sulphur, nickel, chromium and molybdenum was noticed and are depicted in table 1 and 2. Table 1: Macrominerals content in EWP (E. eugeniae) Table 2: Microminerals or trace elements content in EWP (E. eugeniae) The trend observed in macrominerals of E. eugeniae contained a higher concentration of calcium (0.75%) which is followed by magnesium (0.66%), phosphorous (0.36%), potassium (0.33%), nitrogen (0.29%) and sodium (0.19%) respectively. Among the trace elements, iron (1.73%) was found to be maximum followed by selenium (0.96%). Apart from these two micro elements the traces of zinc (0.50%), copper (0.43%), sulphur (0.22%), nickel (0.14%), chromium (0.10%) and molybdenum (0.02%) was also noticed. Discussion Now a day’s importance of minerals is clinical known and these minerals are inorganic chemical elements not attached to a carbon atom.There is a distinction between minerals and trace minerals. If the body requires more than 100 milligrams then that substance is labelled as a mineral. If the cellular body requires less than this, it is labelled a trace mineral. Trace minerals are generally needed in quantities of only a few milligrams (mg) or micrograms ( µg) per day. The higher content of calcium in E. eugenia suggests that this species of earthworm probably has a higher capacity of storage of calcium in its tissues as suggested by the presence of calcium gland in it [17]. The earthworms also contain nutritionally significant amounts of calcium, which would be important for pregnant or lactating women, young children at risk of calcium-deficiency rickets and postmenopausal women in whom there might be concern about osteoporosis and fractures [6]. Earthworms require these minerals for their day to day physiological activities. It may be because they have to burrow or swallow their way through hard packed soil. For in order to perform these various physiological bioactivities, the earthworm must maintain a constant firing (electrical potential) of the nerve and muscle cells and needed for this is the higher calcium and magnesium concentration. Calcium and magnesium have been shown to be involved in regulating nervous excitability and muscular contraction i.e. maintaining the electrical potential in nerve and muscle cells [18]. Nitrogen occurs in all organisms, primarily in amino acids (and thus proteins) and also in the nucleic acids (DNA and RNA). The human body contains about 3% by weight of nitrogen, the fourth most abundant element in the body after oxygen, carbon, and hydrogen [19]. Phosphorous works with calcium to develop and maintain strong bones, teeth and enhances use of other nutrients. It plays a key role in cell membrane integrity, intercellular communication and for proper energy processing in the body. Potassium is important in DNA and protein synthesis, Apart from this potassium is important in cell volume regulation [20]. Sodium in EWP of E. eugeniae was found to be 0.19 ppm. Sodium is the major cation of the extracellular fluid which in conjunction with potassium forms the Na+-K+ pump which effectively maintains Na+ as an impairment extracellular solute [21]. Paloetti et al. [6] reported that all of the earthworm (kuru and motto) preparations were excellent sources of iron, having iron contents that ranged from 1050  µg-1 in kuru’s meat to 2990  µg-1 in motto’s meat. They compared the iron contents of these two earthworm preparations with those of some other meats. This means that, assuming good bioavailability of the iron in the earthworms, they could be a useful food source to mitigate the risk of iron-deficiency anaemia. Selenium is essential component of teeth, key antioxidant enzyme and necessary for normal growth and development. It has a function in detoxification of heavy metals such as mercury and plays an important role in the production of antibodies by the immune system. Zinc is an important antioxidant, which records 0.5% in the present study. It plays an essential part of more than 200 enzymes involved in digestion, metabolism, immune response and wound healing. Copper is an essential element for the formation of normal red blood cell and connective tissue formation. It acts as a catalyst to store and release iron to help form haemoglobin and also contributes to central nervous system function. Sulfur is involved in the formation of structural protein, including muscles and hair. It also severs critical role in liver detoxification. Its important function is to act as an antioxidant nutrient and oxygen handling role in growth. Nickel is found in all animal tissues and the highest concentration was noticed in nucleic acids, particularly RNA, and is involved in protein structure or function. It may activate certain enzymes related to the breakdown or utilization of glucose [22]. Chromium helps in glucose metabolism and aids to regulate blood sugar by potentiating insulin and serving as a component of glucose tolerance factor. Molybdenum contributes to normal growth and development. It is a key component in many enzyme systems involved in detoxification. In conclusion, the minerals in earthworm powder obtained from E. eugenaie are capable of satisfying a significant fraction in daily requirements of minerals which plays a significant role in human nutrition without any adverse side effects. References Ogbulie JN, Uwazuoke JC, Ogieho SI. Introductory Microbiology Practical. Springfield Publishers Nigeria. 1998; 70-120. Ansari AA, Sitaram K. An investigation into antimicrobial and antifungal properties of earthworm powder obtained from Eisenia fetida. American Journal of Food Technology 2011;6(4): 329-335. Balamurugan M, Parthasarathi K, Ranganathan LS, Cooper EL. Hypothetical mode of action of earthworm extract with hepatoprotective and antioxidant properties. Journal of Zhejiang University- Science B 2008;9(2):141–147. Cooper EL. CAM eCAM, bioprospecting: The 21st century pyramid. Evidence-Based Complementary and Alternative Medicine 2005;2(2):125–127. Wallace AR. On the insects used for food in the Indians of the Amazon. R. Entomol. Soc. Lond. 1853;2:241–244. Wallace AR. A narrative of travels on the Amazon and Rio Negro. New York: Dover Publications Inc. 1889. Paoletti MG, Buscardo DJ, Vander Jagt A, Pastuszyn Pizzoferrato L, Huang YS, Chuang LTM, Millson H, Cerda Torres F, Glew RH. Proceedings: The Royal Society of Biological Sciences, London. 2011;249-257. Ranganathan LS. Vermibiotechnology – from soil health to human health. Agrobios. 2006. Cooper EL, Ru B, Weng N. Earthworms: sources of antimicrobial and anticancer molecules. Advances in Experimental Medicine and Biology 2004;546: 359–389. Zhang M, Li X, Liu Y, Ye F, Qiu G. Effects of extract of Dilong (Pheretima) on the scalded skin in rats. Journal of Traditional Chinese Medicine 2006;26(1): 68–71. Cooper EL, Balamurugan M, Parthasarathi K, Ranganathan LS. Earthworm paste (Lampito mauritii, Kinberg) alters inflammatory, oxidative, haematological and serum biochemical indices of inflamed rat. European Review for Medical and Pharmacological Sciences 2007;11(2): 77– 90. Zhang ZX, Wang FF. Effects of crude extract of earthworm on promoting blood circulation to removing stasis. Zhongguo Zhong Xi Yi Jie He Za Zhi 1992;12(12): 741–710. Alvarez S. The Magnesium: Importance of Minerals and Trace Minerals in Human Nutrition. 2002;Pp 22. Dedeke GA, Owa SO, Olurin KB. Amino acid profile of four earthworms species from Nigeria. Agric. Biol. J. N. Am 2010;1(2): 97-102. Jackson ML. Soil chemical analysis. Prentice hall. Indian private limited. India.1973;498-516. AOAC. Association of Official Analytical Chemists. Official Methods of Analysis (20th Ed.) USA. 1995. Lindsay WL, Norvell WA. Development of a DTPA soil test for zinc, iron, manganese, and copper. Soil Sci. Soc. Amer. J 1978;42: 421-428. Owa SO. Taxonomy and Distribution of Nigerian earthworms of the family Eudrilidae and their use as possible indicators of soil properties. Ph.D thesis Obafemi Awolowo University, Ile-Ife Nigeria. 1992. Ganong WF. A review of Medical Physiology (7th Ed). Prentice Hall New Jersey USA. 1995. Murray R, Harry K. Nitrogen Purfication: Pilot Plant Removal of Oxygen. Industrial and Engineering Chemistry 1957;49(5): 869–873. Bray JJ, Cragg PA, Maknight ADC, Mills RG. Lecture notes on human physiology, Blackwell science Ltd, UK. 1999;542. Maier RJ, Stephane L, Benoit, Seshadri S. Nickel-binding and accessory proteins facilitating Ni-enzyme maturation in Helicobacter pylori. Biometals 2007;20(3-4): 655–664.

Bullying: A Force That Must Be Stopped Essay -- Violence

Bullies are looked upon as vestibules of unhealthy tendencies while also harboring deep seeded emotions including anger and hatred. Feelings of anger and hatred can force a person down a path of darkness that only leads one way; into the pit of self-destruction. In present times, these destructive acts can cause a child to become a relic of pain and sullenness; all of these emotions create a bully. â€Å"Bullying is commonly defined as a specific type of aggressive behavior that involves intent to cause harm, occurs repeatedly, and involves a power imbalance.† (Hunt, Peters, and Rapee 156) This aggressive behavior has been constantly studied over the past ten years due to an increase in abnormal tendencies in children and teenagers. Three different categories of bullying exist, â€Å"†¦direct physical bullying, direct verbal bullying, and indirect bullying in which the person or group of persons doing the bullying is not necessarily identified.† (Hunt, Peters, and Rapee 156) All three of these menaces need to be put at halt as much as possible, for if they are allowed to run amuck all that will be produced is chaos. The responsibility of stopping a bully falls upon the teachers and staff members who are charged with ensuring the safety and security of students, and the only possible strategy to stop bullying is to ensure these people are always attentive and aware of their student’s life in the school environment. Easily one the most noticeable type of bullying that exists is the direct and physical approach. More often than not, a bully will physically approach the victim on a daily basis; whether it occurs in the hall, the lunchroom, or after hours. Interestingly enough, an instance of bullying is almost never reported to a teacher or s... ...ayground: Changes Associated With Universal Intervention, Retaliation Beliefs, And Supportive Friends." School Psychology Review 39.4 (2010): 536-551. Academic Search Premier. Web. Mior, AJ. "Do Anti Bullying Programs Work?." Ezine Articles. N.p., n.d. Web. 20 Apr. 2012. . O'Brennan, Lindsey M., Catherine P. Bradshaw, and Anne L. Sawyer. "Examining Developmental Differences In The Social-Emotional Problems Among Frequent Bullies, Victims, And Bully/Victims." Psychology In The Schools 46.2 (2009): 100-115. Academic Search Premier. Web. 17 Apr. 2012. Stop Bullying. U.S. Department of Health & Human Services, n.d. Web. 17 Mar. 2012. . Utterly Global. N.p., n.d. Web. 17 Mar. 2012. .

Cations and Anion Lab Essay

Introduction In this experiment we will be mixing two ionic compounds: potassium chromate and lead nitrate; both are soluble in water. This will be demonstrating a double-replacement reaction/reactions between cations and anions. If a reaction does occur it will form a precipitate due to one of the newly formed compounds not being soluble in water. Once the experiment was completed there was what appears to be a â€Å"solid† substance remaining in the test tube. This shows that a reaction occurred. Procedure 1. Once in the ChemLab-Cations and anion reactions. You will need to obtain a 100mL beaker and 50mL of potassium chromate. This will be done by clicking on the Chemicals section of the toolbar, then selecting 1M Potassium Chromate, change the volume to 50mL, then select to add the Potassium Chromate to a new 100mL beaker. 2. Next, you will need to left click on the beaker, then select Chemicals from the toolbar, select 1M Lead Nitrate, change the volume to 50mL (ensure that the window indicated that it will be placed in the existing beaker. 3. Now you will need to filter the precipitate. Obtain an Erlenmeyer flask and a Buchner funnel. This will be done by selecting from the Equipment section on the toolbar and selecting Erlenmeyer Flask-250mL. Next, right click on the flask and select Buchner Funnel. Right click on the beaker and select Pour/Decant. Move the beaker above the funnel and you will see a white area at the bottom of the flask. 4. Lastly, you will need to record the weight of the precipitate. Right  click on the flask and select Buchner Funnel. A message will appear asking if â€Å"An amount of solid was found present in the filter, what action would you like to take?†, select place solid into 50mL Test Tube. You will now see the Test Tube with the precipitate in the bottom, right click on the Test Tube and click on show weight, the weight of the precipitate will appear, record the weight. Observations and Results There is a small amount of precipitate in the bottom of the test tube that appears yellow in color with some dots in the solution. Weight of filtered precipitate: 16.160g Due to a reaction occurring between the cations and the anions this has caused a reaction, therefore creating a â€Å"solid† that is not water soluble. Discussion When mixing the two ionic compounds: potassium chromate and lead nitrate and then filtering the solution this revealed a â€Å"solid† substance that remained. This substance is not soluble in water hence it was left behind after filtering. This shows that a reaction occurred between the cations and anions. Conclusion This lab represented a double-replacement reaction of the ionic compounds: potassium chromate and lead nitrate. Once these compounds were mixed and then filtered it revealed a â€Å"solid† substance that remained. This confirms that a reaction occurred between the cations and anions, and ultimately formed a new substance.

Participation in Extracurricular Activities Essay

The topic chosen for this Internal Assessment is â€Å"To What Extent Does Participation in Extracurricular Activities Impact on Academic Success of Form 6 Students?† PURPOSE OF RESEARCH/ BACKGROUND TO THE PROBLEM: After casually observing my classmates’ grades, I have seen that some of them who participate in extracurricular activities prosper in their academics whereas some that do not participate in any, seem to fall behind and also, I have observed the exact opposite. This has led me to suspect that there is a researchable problem in which I will aim to evaluate the extent to which participation in extracurricular activities impact on academic success of Form 6 students. Furthermore, this research will serve to guide students as to where to allocate their time, in relation to extracurricular activities, so they may attain better school grades. Although many studies have been conducted on the impact of extracurricular activities on academic success, my research is specifically directed to Form Six students of a particular school, St. Joseph’s Convent, St. Joseph. Most Form Six students are involved in one or more extracurricular activity, whether it is in school or outside of school. And now that we are in a critical stage in our academic development, sitting the Caribbean Advanced Proficiency Examination, it is important to understand the value that extracurricular activities plays in helping us achieve academic success. EDUCATIONAL VALUE: This research shows a great deal of educational value. Extracurricular activities are seen as extremely important by many universities and are a requirement when applying. My study will explain why extracurricular activities are so important to the development of a student, in particular, their academic results. It will investigate and analyse the impacts extracurricular activities have on academic success from which students and their guardians can review the findings and may benefit from the information provided. It is hoped that everyone who reads my research will come away with a better understanding as to the importance of extracurricular activities and its’ impacts on academic success. TECHNICAL TERMS: 1. Extracurricular Activity- activities that impart knowledge or skill not falling within the scope of the regular curriculum. 2. Impact – influence; effect. 3. Academic Success: Favorable or prosperous results relating to education or scholarship. 4. Participation – the fact of taking part, as in some action or attempt RESEARCH QUESTIONS: 1. Is there any correlation between extracurricular activities and academic results? 2. What are the positive and negative impacts of extracurricular activities on students’ academics? 3. How much time spent doing extracurricular activities is most ideal for the average student? 4. Are there certain types of extracurricular activities that impact academic success more than others?

Waiting for Social Security Disability

Waiting for Social Security Disability Social Security Disability: The Ultimate Waiting Game The process for Social Security Disability is not an easy one, and it certainly is not fast. At the initial application level there are very low approval rates, extremely over-worked Social Security employees, and incredible hardships faced by the claimants. All of this mixed together results in a frustrating experience for the person who is trying to secure an income to help their family.One of the hardest parts of the entire process is the waiting. You can’t work, you have no income, the bills are piling up, and there are notices coming in almost weekly. It seems like there is no end in sight.After you submit your request for a hearing, the biggest wait time begins. The wait times for a hearing vary between each office. Here are Michigan’s hearing offices and their average wait times for cases that were heard in September, 2016:Detroit  15 monthsFlint  18 monthsGrand Rapids  18 monthsLansing  17 monthsLivonia  13 monthsMt. Pleasant  19 monthsOak Park  16 monthsIn comparison, the shortest waiting period belongs to Fort Smith, AR at 8 months, and the longest waiting period is in Ponce, Puerto Rico at 27 months (25 months in Buffalo, NY is the highest for states). The average wait time for all of the hearing offices is 17.7 months which shows that Michigan is experiencing roughly average wait times.One of the biggest contributing factors is the huge backlog of cases. Since there is such a low approval rating on the initial applications, there is a huge number of people filing appeals. The more people with appeals pending in a certain area, the longer the wait time.There is a light at the end of the tunnel though. For the 2016 fiscal year, more hearings were heard than scheduled.If you are finding yourself in a hardship situation, you may be able to speed up your case. This is never guaranteed, and there are no definite set of guidelines for approval, but it is always worth a shot.Additionally, if you need help with food, bills, or gen eral living expenses, please check out the Resources area of our website, contact the United Way at 411, or look into local charities and churches.

Food safety management systems Essays

Food safety management systems Essays Food safety management systems Essay Food safety management systems Essay 1.1 Enterobacteriaceae An increased consciousness and a better apprehension of the nutrient industry and its associated hazards with microbiological taints have been the consequence of the broad usage of nutrient safety direction systems in Ireland. Hazard Analysis Critical Control Point ( HACCP ) is the chief nutrient safety system used throughout nutrient industries. Although this system was introduced in the 1960 s it was merely in 1998 that the EU Hygiene of foodstuffs Regulations implemented this referential in all nutrient concerns in Europe ( Food Market Exchange 2001 ) . Microbiological controls are performed to guarantee the quality and safety of the nutrient merchandises. The patterned advance in scientific discipline and microbic engineering hold given a better apprehension of nutrient production, processing and saving and the nexus between the microscopic and macroscopic universe. This relation enables micro-organisms to be exhaustively examined and evaluated. Food borne unwellnesss are the mos t widespread public wellness jobs, making societal and economic loads along with human enduring. In order to seek cut downing the hazard of such unwellnesss and nutrient poisonings, hygiene steps are required in nutrient processing environments ( Microbiological hazard appraisal 2006 ) . The presence of Enterobacteriaceae in nutrient or food-contact surfaces in such environments serves as hygiene indexs. : Enterobacteriaceae are a big household of bacteriums that comprise of at least 34 genera, 149 species and 21 races. Cells are typically 0.3-1.8AÂ µm in length. ( Blackburn day of the month? ) They are rod shaped, Gram negative facultative anaerobes and are natural dwellers of bowels in both worlds and animate beings. They are found extensively throughout the dirt, H2O, on fruit, veggies and cereals. They play a considerable function in human wellness as many pathogens fall under this household which are known to do many infective diseases. Harmonizing to Kang et Al ( 2007 ) a minute sum of 10 settlement organizing units ( CFU s ) of peculiar micro-organisms can take to life endangering infections particularly in the immune-compromised. Salmonella typhimurium is responsible for typhoid disease while Escherichia coli is a common cause of stomach flu. ( Becker et al 2008 ) . Other Enterobacteriaceae associated diseases include infirmary acquired pneumonia, blood stream infections such as bacteraemia and blood poisoning, urinary piece of land infections and intra abdominal infections ( Denton 2007 ) . Enterobacteriaceae have been preponderantly associated with nutrient pathogen eruption. As discussed by Reilly et Al ( 1988 ) 224 eruptions of salmonellosis associated with domestic fowl meat were reported in Scotland entirely between 1980 and 1985. Among the 2245 people infected 12 died. Salmonella typhimurium and Salmonella enteritis were the chief serotypes associated with the eruption. In recent old ages the serotype Enterobacter sakazakii now known as Cronobacter sakazakii been identified as an emerging pathogen. It has been found in infant milk expression and has been the cause of neonatal meningitis and sepsis. It targets immune-compromised babies and those with a low birth weight. ( Van Acker et al 2000 ) In the 1920 s coli-aerogenes ( coliform ) group was indispensable as an index in the proof of equal processing processs in the dairy industry i.e. Pasteurization of dairy merchandises. It is apparent that since the 1950 s the full Enterobacteriaceae household has been preferred over other taxons as marker beings as they are known to be better defined when it comes to their finding and the household includes more beings of significance than other households. In the 1980 s Escherichia coli was foremost used as a mention being in the monitoring of imbibing H2O supplies. ( Mossel and Stryijk 1995 ) A microbic index harmonizing to Moore and Griffith ( 2000 ) is a microorganism that is an index for the possible presence of pathogens. 1.2 Adherence of Enterobacteriaceae to surfaces. The adhesion of micro-organisms to surfaces in the nutrient industry chiefly on treating equipment is one of the major concerns in the equal control of quality and safety of nutrient merchandises. If cleansing and sanitation are deficient, micro-organisms on the surface can last by the development of a biofilm. ( Ortega et al 2009 ) . A biofilm reduces susceptibleness to disinfectant and increases polysaccharide production. The happening of a biofilm can take to post processing taint taking to a lowered shelf life of a merchandise and the transmittal of diseases. In add-on it has been known to do mechanical obstruction, damage of heat transportation, addition in unstable frictional opposition and the corrosion of metal. ( Fuster-Valls et al 2007 ) To day of the month no ideal method for finding the cleanliness of surfaces has been available. The combination of ocular, non microbial and microbiological methods can take to an integrated cleansing monitoring scheme. ( Griffith et al 1997 ) . The ability to quantify micro-organisms on nutrient contact surfaces provides indispensable information for patterning consumer exposure from cross taint in the nutrient industry through nutrient production, nutrient conveyance and in nutrient service environments. Many infective bacteriums have been known to adhere to surfaces particularly unstained steel, glass and gum elastic. Stainless steel is used extensively throughout the nutrient processing and the nutrient conveyance industry. As described by Ortega et Al ( 2009 ) , unstained steel is most widely employed due to its mechanical strength, corrosion opposition and easiness of fiction . Despite looking smooth to the unaided oculus, when chromium steel steel is viewed under the microsco pe it is shown to be really unsmooth with many distinguishable defects. These defects are thought to harbor bacterial cells which with the add-on of H2O and foods would heighten the micro-organism s endurance ( Moore and Griffith 2002 ) . There have been limited surveies on the adhesion behavior on Escherichia coli on chromium steel steel. Ortega et Al ( 2009 ) stated 108cfu/ml of civilization on chromium steel steel for 2 H at 20Â °C was under the sensing bound. In contrast another survey suggested 105cfu/cm2 were found on chromium steel steel after vouchers were inoculated with 108cfu/ml at 4 Â °C for 24 H. 1.3 Sampling of surfaces with swabs and sponges. Harmonizing to Hall and Hartnett ( 1964 ) , a simple convenient sample process would be utile to trace path of infection , for the identification of human bearers, rating of decontamination processs and bacteriological surveillance of the environment which could hence take to in-service preparation of forces concerned with sanitation . Surface sampling is going progressively of import and legion probes have been afoot to happen a simple, dependable, bacteriological trial to find, quantitatively, the healthful quality of environmental, nutrient and hand-contact surfaces. ( Angelotti et al 1958 ) . Cleaning agendas in the nutrient industry are designed chiefly to cut down both nutrient dust and to decrease microorganisms to degrees that pose small or low hazard to both safety and the quality of the merchandise. ( Moore and Griffith 2002 ) Traditional swabs are made from a wooden or plastic shaft with cotton, rayon, Dacron, or alginate fibers which are spun organizing a bud at one terminal. Moore and Griffith ( 2007 ) discourse how the wetting agents applied to swabs have dramatic effects on the sum of bacteriums recovered from a surface. The chief points to be assessed in finding how effectual peculiar swab types are depend on the remotion of bacterial contaminations from a surface, the release of these bacteriums from the swab bud and the subsequent cultivation . It was found that cotton swabs absorbed more liquid than other swabs evaluated. When bacteriums were recovered from wet surfaces it was apparent that coppice textured, Rayon and Dacron tipped swabs removed a significantly fewer CFU s compared to the cotton swabs. It was shown how cotton swabs performed every bit every bit good when trying a dry surface. Moore and Griffith ( 2007 ) province that cotton swabs consist of a secondary wall that is made up of cellulose. This enables the cotton to swell when positioned in wetness to ensue in an increased soaking up of liquid together with bacteriums entrapped indoors. These positive features that enable cotton swabs to take high degrees of bacteriums from a surface are thought to impede the swabs release of the bacterium. It can be predicted that the usage of a swab with a hapless initial absorbency could later ensue in a higher overall bacterial recovery with the assistance of dilutants to ease bacterial release. Moore and Griffith ( 2007 ) besides discuss how it was apparent upon go forthing the swabs at room temperature for 24 H that the release of bacteriums from the cotton swab was greater than other swabs. It was apparent that the bacterium became entrapped within the cotton fibres hence protecting the bacterium and assisting to make a microenvironment enabling the bacterium to last. In contrast to Moore and Griffith ( 2007 ) statements, Copan Italia ( 2010 ) shows how unfastened cell froth swabs have good release of the bacteriums but demonstrated soaking up of 3-5 times less than in traditional fiber swabs due to their construction ( Figure 1 ) . The development of Flocked swabs which have good releasing belongingss and can absorb five times more than cell froth swabs are widely used in clinical nosologies but have nt been applied yet to the recovery of Enterobacteriaceae throughout the nutrient industry. 1.4 Biochemical trials for the sensing and quantification of Enterobacteriaceae and their restrictions. Current biochemical and civilization based checks tend to be cheap and comparatively simple nevertheless there are restrictions with such trials. One of the chief restrictions includes the length of clip that is needed for the sensing and numbering of bacteriums. False- positive consequences, the loss of viability of bacteriums from aggregation to its numbering and the deficiency of growing of feasible yet non cultural bacteriums have been associated with current biochemical and civilization based checks. ( Rosrak and Colwell 1987 ) Today the Gram discoloration process is of common usage in research labs as the first method of designation for a micro-organism. The method was originally published in 1883 by Hans Christian Gram. This technique nevertheless is nt ever demonstrative of true Gram nature. Some Gram positive bacteriums may stain Gram negative due to cell wall harm in the bacteriums by over exposure to O. ( Bahrani Mougeot et al 2008 ) Blackburn ( day of the month? ) stated that the proving for enteral pathogens such as Salmonella requires specific methods that are labour intensive and can take several yearss to finish. Furthermore, infective bacteriums in nutrient are frequently non homogeneously distributed and are present in low Numberss doing sensing hard. Many nutrient production sites chiefly prefer to prove for enteral pathogens in external research labs while the testing of E.coli and Enterobacteriaceae are routinely tested to supply convenient appraisal of possible fecal taint. Many methods published from International Organisation for Standardisation ( ISO ) methods are available, where many processs of sensing are quantitative. The bulk of nutrient makers impose acceptable bounds for a given micro-organism. The Most Probable Number ( MPN ) technique from ISO 4831:2006 ( ISO 2010 ) and plating utilizing pour or spread technique are chiefly used. Violet Red Bile Glucose Agar ( VRBGA ) and Violet Red Bile Agar ( VRBA ) incorporating lactose have been deemed the most popular media for analyzing nutrients for Enterobacteriaceae. Their sensing and numbering are based chiefly on their ability to bring forth acid and gas from the agitation of glucose and milk sugar which is detected by the pH index impersonal ruddy. An sheathing is recommended to guarantee agitation of the saccharides and to cut down the hazard of oxidization every bit good as bettering the specificity of these media and later cut downing intervention from background vegetations or motile strains ( Blackburn day of the month? ) . There has been grounds that non Enterobacteriaceae bacteriums can turn on VRBA and VRBGA hence proposing that this method can impede specificity. The growing of Aeromonas spp has been detected on VRBGA harmonizing to Petzel and Hartman ( 1985 ) and VRBGA has been seen to be insufficiently selective bespeaking 52.4 % of consequences obtaine d to be false- positive ( Wook Oh and Kang 2004 ) MPN methods can supply greater sensitiveness compared with plating techniques when the taint degrees are low. However if the concentration of taint is high the consequences show greater fluctuation and may take to false positive consequences. MPN technique consists of multiple tubings of different media including Buffer Peptone H2O, Enterobacteriaceae enrichment stock. ( See figure 2 ) Enterobacteriaceae are oxidase negative and this trial is used to prove for the presence of the enzyme cytochrome oxidase to corroborate presumptive settlements in correlativity with glucose agar trial which tests for agitation of glucose. If agitation occurs it consequences in abundant production of acerb terminal merchandises ensuing in a color alteration. This method required by ISO described by Rose et Al ( 1974 ) has low preciseness and inordinate clip is necessary for analysis runing from 5-7 yearss. APIa„? designation systems from Biomerieux are used widely throughout research labs. ID32E, is a standardized system in which the designation of Enterobacteriaceae and other not fastidious Gram negative bacteriums can be quickly identified. Many surveies have been reported utilizing API as method of designation including those of Drudy et Al ( 2006 ) and Galani et Al ( 2007 ) . The API/ID32E sensing kit is the most extended of the scope of API merchandises available. It includes 15 designation systems covering all groups of bacteriums encountered in industrial microbiological research labs ( BioMerieux, 2010 ) . The dependability of APIa„? designation systems it used throughout industries. Janda et Al ( 2001 ) stated nevertheless that the trials included in the API 20E strip in 1975 were still the same in 2001 even if the Numberss of taxons in the Enterobacteriaceae household has increased well between those old ages. The ready to utilize Petrifilm system has been released by 3M health care for the sensing of foodborne pathogens. It s easy to utilize technique comprises a selective media under a transparent movie ( 3M health care ) . The media is hydrated by the add-on of bacterial suspension and after incubation seeable settlements can be counted. ( Blackburn? ? ) Despite this method being speedy and convenient, Petrifilm systems are expensive. Restrictions of this technique discussed by Mueller et Al ( 2009 ) show that some settlements shown on Petrifilm are excessively little to see from bare oculus. Therefore the usage of magnification for accurate visual image is required. It was shown that some beings can liquefy the gel on the movie leting spreading of growing and subsequent harm to other bing settlements supplying a lower count of settlements. Standard methods such as conventional civilization and biochemical based checks used to recite necessitate 18-24 H for consequences to be obtained. Progresss in modern molecular biological science have seen the development of molecular checks such as the polymerase concatenation reaction ( PCR ) that have become highly dependable and important in the sensing of bacterial species ( Khan et al 2007 ) . 1.5 Alternate DNA- based method for the sensing and quantification of Enterobacteriaceae 1.51 DNA extraction The rules of DNA extraction as discussed by Jordan ( 2008 ) include the debasement of microbic cell wall to let go of the Deoxyribonucleic acid and to sufficiently take sample constituents which can cut down assay efficiency and degrade the Deoxyribonucleic acid. Due to the complexness of nutrients matrices there are many inhibitors of DNA extraction including saccharides, fats, proteins, metal ions, phenoplasts and cell dust. 1.52 Polymerase Chain Reaction Polymerase Chain Reaction ( PCR ) is one of the most widely used molecular biological science techniques in the research lab. This is due to its specificity, flexibleness, singular velocity and its resiliency ( Mc Pherson et Al 1995 ) . PCR was developed in the 1980 s and the technique has been continuously improved and modified to spread out its versatility and pertinence . This Deoxyribonucleic acid based method has become an indispensable and day-to-day performed experimental technique in many research Fieldss and clinical research labs to observe infective agents, to magnify familial stuffs from limited volumes of DNA sample ( AÂ µl ) and for cloning for sensing of familial look degrees. ( Yang et al 2005 ) . PCR is utile for both the diagnosing and direction of a assortment of infective diseases. ( Louis et al. , 2000 ) PCR Mix: PCR mix is made up of DNA polymerase, a forward and a contrary primer, bases, a DNA Target and PCR buffer with MgCl2. PCR stairss PCR elaboration can turn a few molecules of a specific mark nucleic acid into a mcg of DNA. Roche PCR Applications Manual ( 2006 ) explained how the procedure of PCR occurs in three chief stairss of 1 ) Denaturation, 2 ) Annealing and 3 ) Extension with the usage of temperature cycling ( figure 3 ) . Denaturation occurs at 90Â °C when heat separates double stranded DNA into two individual strands. Since the H bonds associating the bases to one another are weak they break at such high temperatures, whereas the bonds between the deoxyribose and phosphates which are strong covalent bonds remain integral. The end of PCR procedure is non to retroflex the full strand of Deoxyribonucleic acid but to retroflex a mark sequence of about 100-35,000 base brace that is alone to the being. Primers are used to specify the terminals of that sequence. Primers are short, man-made sequences of single- stranded DNA typically dwelling of 20-30 bases. The annealing measure takes topographic point between 40Â °C to 65Â °C depending on the length on the length and sequence of the primers. This allows the primers to temper specifically to the mark sequence. Once the primers anneal to the complementary DNA sequences, the temperature is raised to about 72Â °C and DNA polymerase begins to synthesise new dual stranded Deoxyribonucleic acid molecules that are indistinguishable to the original mark DNA. It does this by easing the binding and connection of complementary bases that are free in solution ( dNTPs ) . Synthesis ever begins at the 3 terminal of the primer and returns entirely in the 5 to 3 way. The new synthesis efficaciously extends the primers, making a complementary two-base hit stranded molecule from a single-stranded templet. After the PCR procedure is complete, cataphoresis must be completed in order to For the sensing of bacteriums within nutrients the mechanism of PCR has proved to be really effectual. Low degrees of 3cells of Campylobacter were found in meat samples utilizing this technique ( Waage et al 1999 ) . However During PCR elaboration, short Deoxyribonucleic acid sequences are copied at each rhythm. Theoretically the sum of Deoxyribonucleic acid at each rhythm should duplicate at each rhythm, ensuing in an exponential elaboration of the initial mark DNA. Fraga et Al ( 2009 ) demo how this is potentially true during the early phases of the reaction when the constituents present in PCR are in huge extra compared to the mark sequence. As the merchandise accumulates, the substrates become low ensuing in suppression. In order to look at the efficiency of the reaction, PCR can be divided into three distinguishable stages: exponential, additive and tableland. The first stage is exponential stage in which the reaction is 100 % efficient with the doubling of merchandise at each rhythm. As the amplicon exponentially accumulates in measure the PCR constituents are used up and the primers begin to vie with the amplicon and the reaction efficiency later decreases. As the reaction slows down the additive stage begins. The merchandise formed in this stage is extremely variable due to the rate at which peculiar constituents are depleted and the accretion of merchandises. The tableland stage is when the reaction Michigans due to depletion of substrates and the suppression of merchandises. There is an highly big difference between the additive stage and the concluding sum of merchandise produced. In conventional PCR, sensing of PCR merchandise is completed late in the additive stage or at plateau stage. As seen in figure 5 there can be a distinguishable difference in the two stages demoing that conventional PCR is variable when it comes to quantitative consequences. 1.42 Real clip PCR The development of existent clip quantitative PCR ( QPCR ) presents more rapid, specific and quantitative numbering of peculiar mark cistrons as they are amplified in existent clip. In existent clip PCR the sum of merchandise formed is monitored during the class of the reaction by supervising the fluorescence of dyes or investigations introduced into the reaction that is relative to the sum of merchandise formed, and the figure of elaboration rhythms required to obtain a peculiar sum of DNA molecules is registered. ( Kubista et al 2006 ) . Real clip PCR checks are characterized by a broad scope of quantification of 7-8 logarithmic decennaries, high proficient sensitiveness, high preciseness and it does nt necessitate any station PCR steps hence the hazard of taint is reduced. ( Klein D 2002 ) Real clip PCR processs follow the same rules of conventional PCR in the readying of mixes and cycling of temperature. This rapid sensing method uses a sensing format, normally a fluorescent dye that binds to the PCR merchandise. The sum of fluorescence generated is relative to the sum of PCR merchandise formed. Initially the signal is weak and hence indistinguishable from the background but as the PCR merchandise accumulates, the fluorescence can be acquired by the existent clip PCR device. A threshold line is developed by the existent clip device and the CT value is determined. CT value is the figure of rhythms required to make fluorescent threshold. Real clip PCR generates a CT value for each DNA sample which is hence relative to the transcript figure DNA. Normally used fluorescent Reporters SYBR Green 1. Asymmetric cyanine dyes such as SYBR Green 1 have two aromatic systems incorporating N, one that is positively charged connected by a methine span. The dye has virtually no fluorescence when free in solution due to quivers prosecuting both aromatic systems, which convert electronic excitement energy into heat that dissipates to the environing dissolver. When the dyes bind with DNA they emit fluorescence. ( Nygren et al 1998 ) As disussed by LightCycler Rea clip PCR Systems ( 2009 ) , SYBR Green binds to all double stranded Deoxyribonucleic acid molecules irrespective of the sequence. When it comes into contact with dual stranded Deoxyribonucleic acid its fluorescence additions significantly. Harmonizing to Monis et Al ( 2005 ) SBYR Green 1 has a restriction in dye stableness and dye dependent PCR suppression and the selective sensing of amplicons during DNA runing curve analysis. HYBRIDISATION PROBES HYDROLYSIS PROBES TAQMAN PROBES LUX PRIMERS SYBR Green 1 is normally used in existent clip PCR. However, these asymmetric dyes nevertheless are considered sequence non-specific newsmans in real-time PCR. They tend to breathe fluorescence signal to all double stranded DNA even unwanted primer-dimer merchandises. Primer dimer merchandises interfere with the formation of specific merchandises due to competition of the two reagents and may take to wrong readings. Melting curve analysis can easy recognize primer-dimer formation. Temperature is increased and fluorescence is measured as a map of temperature. As temperature additions, fluorescence lessenings due to increased thermic gesture. When dual stranded DNA separates an disconnected bead in the fluorescent signal occurs. Since primer-dimers are shorter and they tend to run at a lower temperature, they are easy recognised in runing curve analysis. Light Upon Extension ( LUX primer ) : based on oligonucleotides labelled with a individual fluorophore. They do non necessitate a quencher mediety includes a single-labeled primer with a FAM fluorophore at the 3 terminal in a hairpin construction and a corresponding unlabelled primer, designed to amply the 5 terminal of the cistron encoding the S protein ofTGEV. The constellation of the labelled primer enables the fluorescence slaking capableness. When the primer is incorporated into double-stranded RT-PCR merchandise, the fluorophore is dequenched, ensuing in a important addition in fluorescent signal Unlike the current good known real-time engineering that relies on a man-made DNA investigation labeled with two different fluorescent dyes, LUX primers engineering does non necessitate an expensive investigation so is more suited for everyday research lab diagnosing. What a LUX check demands is a specific primer set with a individual labeled, self-quenched primer and a corresponding unlabelled one, it is more dependable than the real-time method usingDNA bindingdyes that may bring forth potentially deceptive consequences due to the deficiency of specificity of the dyes. A old survey besides indicates that the LUX primers engineering is dependable for quantitation of cistron look and the consequence is similar to the probe-based quantitative check ( Brian et al. , 2003 ) . LUX fluorogenic primers can be designed and ordered via online package. The LUX check besides has the advantage of addition velocity and is less arduous over the gel-based RT-PCR technique that is presently the everyday cistron analysis tool forTGEV. The LUX assay took less than an hr to finish the elaboration reaction and the procedure was viewed in existent clip, while conventional RT-PCR methods normally take more than 1h for cistron elaboration and half an hr or more to run the gel and analyze the consequence. The advantage of velocity of the LUX check is more evident when compared to other everyday diagnostic methods for TGE Furthermore, the LUX check is closed-tube and one-step technique, which reduces the hazard of taint and reaction variableness. This sensitive and specific trial complements bing cistron methods for the sensing ofTGEV. The method shall turn out to be a valuable tool in the research lab diagnosing ofTGEV, particularly as a agency of corroborating positive consequences from serological trials. LUX primers engineering supports manifold elaboration ( hypertext transfer protocol: //www.invitrogen.com/lux ) that makes observing different pathogens in a individual check possible. By utilizing two sets of primers, each labeled with a different dye, a individual LUX check can observe two different viruses. LUX primers are compatible with a broad assortment of real-time PCR instruments ( hypertext transfer protocol: //www.invitrogen.com/lux ) . More checks can be developed for the sensing of other pathogens. By cut downing the cost of real-time cistron sensing and with high public presentation, LUX fluorogenic primers engineering may has the possible to be used widely in the field ofanimal diseasesurveillance and control every bit good as import and export carnal quarantine direction. Advantages of utilizing DNA for microbic Testing Deoxyribonucleic acid is stable and unswayed by environmental factors while being independent from bacterial fundamental law doing consequences conclusive non subjective. It is accurate due to species specific mark sequence which is unattainable with cultural methods and public presentation controls can be added. There are good established DNA sensing methods available which enable fast sensing. Reliable industry of primers and investigations. 2.1 Preparation of Deoxyribonucleic acid from bacterial strains The undermentioned Enterobacteriaceae strains were obtained ( MicroBioLogics Inc, Minnesota, USA ) Escherichiacoli ( ATCC 11775 ) , Serratiamarcescens ( ATCC 13880 ) , Enterobacteraerogenes ( ATCC 13048 ) , Salmonella typhimurium ( ATCC 13311 ) Erwinia persicina ( ATCC 1381 ) Shigella flexneri ( ATCC 9199 ) Klebsiella pneumonia ( ATCC 700603 ) , Yersinia enterocolitica ( ATCC 9610 ) Listeria monocytogenes ( ATCC 19115 ) , Vibrio parahaemoliticus ( ATCC 17802 ) , Aeromonas hydrophila ( ATCC 7966 ) and Campylobacter jejuni ( ATCC 29428 ) . The University of Limerick supplied the strains Cronobacter sakazakii, Enterobacter cloacae, Pseudomonas aeruginosa and Proteus Mirabilis. The National Collection of Type Cultures ( Health Protection Agency Culture Collections, Salisbury, UK ) supplied Staphylococcus aureus ( NCTC 8325 ) . All strains of bacteriums were stored on Protect beads 109 ( LangenBach services Ltd, Dublin, Ireland ) at -20Â °C until cultivation. All Enterobacteriaceae strai ns grown on alimentary agar ( NA ) ( Oxoid, Basingstoke, UK ) at 37Â °C for 24hr AÂ ± 2 hour except Erwinia persicina which was grown at 30Â °C, Listeria monocytogenes and Staphylococcus aureus grown at 37Â °C. Vibrio parahaemoliticus grown at 35Â °C on Trypic soybean agar ( TSA ) ( Oxoid ) Confirmation and Identification of the mention micro-organism E coli. The designation of Escherichia coli ( ATCC 11755 ) was verified by the undermentioned biochemical trials. The Gram discoloration process was applied to a settlement from the fresh civilization on NA. Oxidase trial was carried out utilizing oxidase strips ( bioTRADING, Dublin, Ireland ) . A positive control of Pseudomonas aeruginosa and a negative control of Staphylococcus aureus were used to corroborate the dependability of the trial. API designation utilizing ID 32E was carried out harmonizing to maker s instructions ( BioMerieuxAÂ ®S.A, Craponne, France ) and identified utilizing the package Apiweb ( BioMerieux ) 2.2 Preparation of bacterial suspension. Pre-cultures were prepared by infixing a loop full of bacterial settlement into Nutrient Broth ( Oxoid ) with incubation of 37Â °C for all Enterobacteriaceae with the exclusion of Erwinia persicina which was grown at 30Â °C, Listeria monocytogenes and Staphylococcus aureus grown at 37Â °C. A loop full of Vibrio parahaemolyticus was grown at 35Â °C on Tryptic Soya Broth ( TSB ) ( Oxoid ) In peculiar the growing of Escherichia coli in alimentary stock was studied by mensurating the optical denseness and home base numeration. Spectrophotometric measurings were obtained at 600nm utilizing ( insert name here ) .Optical denseness was acquired every 30min from 0min to 4h 30min 2.3 Usual spiking of vouchers and recovery by swobing. Stainless steel vouchers of class 304 were obtained. Regions to be spiked with Escherichia coli were indicated utilizing a templet ( ) ( 10cm x 10cm ) . Each voucher was spiked by pipetting 100AÂ µl of Escherichia coli civilization onto the surface and utilizing a spreader ( ) . After allocated clip ( 0min 30min or 60min ) , vouchers were swabbed utilizing cotton swab. Each voucher was swabbed twice: horizontally and vertically. Each swab was cut and placed into the interior tubing of swab extraction tubing system ( SETS ) ( Roche Diagnostics, Mannheim, Germany ) .Each aggregation tubing was later centrifuged at 10000g for 10min ( Sigma1-15 ) . Then the inner tubings and the supernatants were discarded. Pellets were re-suspended in 250AÂ µl Ringer one-fourth strength solution ( Oxoid ) . Dilution series in one-fourth strength toller solution were prepared, plated out on alimentary agar and incubated 18-24h at 37Â °C. 2.4 Study of the release of Bacteria from different swabs and sponges. Comparative survey of the recovery of Escherichia coli cells was performed utilizing cotton, rayon and alginate swabs. ( Copan Italia S.p.A, Brescia, Italy ) . 100AÂ µl of 18h Escherichia coli civilization were deposited straight onto each swab. Swabs were cut and placed into SETS tubes. Tubes were centrifuged at 10000 g for 10 min. Pellets were re-suspended with 200AÂ µl of quarter-strength Ringer Solution ( Oxoid ) . Dilution series were made and 100 AÂ µl of diluted sample were plated onto alimentary agar home bases ( Oxoid ) that were incubated at 37Â °C for 24 H. Large sponges ( Medical Supply Co Ltd, Dublin, Ireland ) were tested to retrieve bacteriums from surfaces by swobing after allocated clip ( 0 min, 30 min, 60 min ) . Each sponge impregnated with 10ml Maximal Recovery Diluent ( MRD ) ( Oxoid ) was inserted into a stomacher bag ( ) supplemented with 100ml of MRD and stomached utilizing stomacher ( ) for 120 s at high power. Dilution series were made and 100AÂ µl of diluted sample was plated onto alimentary agar home bases ( Oxoid ) that were incubated at 37Â °C for 24 H 2.5 Detection and Quantification of feasible bacteriums from surfaces. Plate numeration expression was obtained as per ISO 4833:1991 ( Harrigan W.F 1998 ) which has since been renewed to ISO 4833:2003 Microbiology of nutrient and animate being eating materials Horizontal method for the numbering of micro-organisms Colony-count technique . The home base numeration expression was? c/ ( n1 + 0.1 n2 ) vitamin D where? degree Celsius was the amount of all settlements counted on all dishes, n1 was the figure of dishes in 1st dilution, n2 was figure of dishes in 2nd dilution and vitamin D represented the dilution. Miles and Misra method as per Harrigan W.F ( 1998 ) was used in peculiar when proving recovery of Escherichia coli from the big sponges. 2.10 Bacterial designation of bacteriums in the suspension used to make the unreal nutrient environment on surfaces. The suspension was prepared from 34 swabs samples that were collected from nutrient contact surfaces in Dawn Fresh Food Company, Fethard, Co. Tipperary. Each swab was assorted with 0.1 % peptone H2O ( Oxoid ) and the suspension were pooled together to make one chief suspension that was assorted with half volume glycerol 50 % ( Sigma Aldricha„? Inc ) . This suspension was aliquoted into 1ml eppendorf tubings and maintain in at -80Â °C. A entire feasible count was determined by utilizing the Miles and Misra method and later by home base numeration following a dilution series of bacterial suspension. The sensing of Listeria monocytogenes, Staphylococcus aureus and the Enterobacteriaceae were targeted. In the instance of Listeria monocytogenes 1ml of sample was dispensed into 9ml Buffer Peptone H2O ( Oxoid ) . Incubate 37Â °C for 18-24hours. After 24 H transportation 10ml from tubing into 90ml of Listeria Enrichment stock ( Oxoid ) , incubate for 48 H at 30Â °C guaranting agitation. After 48 h a loop full of solution was streaked on a Listeria agar home base ( Oxoid ) and incubated for 48 H at 30Â °C. Listeria Petrifilm ( 3Ma„? , Dublin, Ireland ) was used following maker s instructions. For the designation of Staphylococcus 100AÂ µl of unreal nutrient environment was plated on baird Parker agar ( Oxoid ) administering the organic burden throughout the home base utilizing a spreader and incubated at 37Â °C for 48 h. After 48 h agglomeration was tested utilizing PastorexAÂ ® Staph Plus trial. ( Biorad ) . Catalase activity was tested by the add-on of H2O2 ( ) . Each suspected Staphylococcus aureus settlement was placed in 1ml of toller solution that was later pipetted on to Staph Petri movie ( 3Ma„? ) . Petri movie was placed in brooder for 24 H at 37 Â °C. Enterobacteriaceae was detected utilizing most likely figure ( MPN ) See appendix. 2.6 DNA extraction: For specificity for PCR checks, bacterial pellets were obtained antecedently from civilizations in exponential growing stage were used with the exclusion of Camplyobacter jejuni. One settlement of C.jejuni was resuspended in 0.1 % Peptone H2O ( Oxoid ) and centrifuged at 5000 g for 5 min. For the quantification of bacteriums from surfaces, pellets were recovered from SETS after centrifugation of 1ml of civilization at 5000 g for 5 min. A rapid purification of DNA samples utilizing DNeasy Blood and Tissue Kit ( Qiagen, West Sussex, UK ) was preformed following maker s instructions. Deoxyribonucleic acid was extracted, purified and later quantified utilizing Nanodrop ND 1000 spectrophotometer ( ThermoScentific, Wilmington, USA ) Deoxyribonucleic acid concentrations were adjusted to 1ng per 2AÂ µl 2.7 Choice of Primer sets. 2.7-1 ENT Primers ENT primers developed by Nakano et Al ( 2003 ) and designed to temper to the 16S rRNA cistron of Escherichia coli. The sequence of the forward primer: 5GTTGTAAAGCACTTTCAGTGGTGAGGAAGG 3was 425 through 454 in the E. coli 16S rDNA while the sequence of the contrary primer 5GCCTCAAGGGCACAACCTCCAAG 3 had places 826 through 848 in the E.coli 16S rDNA. ENT primers expected to take to formation of 419-425 bp of PCR merchandise. 2.7-2 IEC primers: IEC primers as described by Khan et Al ( 2007 ) are oligonucleotide primer braces derived from the distal and proximal conserved flanking parts of the16S rRNA cistron, the Internal Transcribed Spacer ( ITS ) part and the 23S rRNA.IEC frontward primer 5CAATTTTCGTGTCCCCTTCG 3 and change by reversal primer 5GTTAATGATAGTGTGTGTCGAAAC 3 had expected PCR merchandise length of 450bp. 2.8 PCR Conditionss For a individual PCR 25 AÂ µl PCR reaction, PCR maestro mixes were prepared with unfertile DNA H2O, PCR buffer 2mM MgCl2, 25mM MgCl2, a dNTP mixture ( dATP, dTTP, dCTP, dGTP ) , frontward primer, change by reversal primer, DNA polymerase and 2AÂ µl of peculiar DNA. PCR was carried out on G-STORM GS2 Thermal Cycler. ( Familial Research Instrumental Ltd, Braintree, UK ) . The elaboration conditions were as follow: stopping point palpebra and heated to 111Â °C, 95Â °C for 6 min, bacterial rhythm start of 28ycles, denaturation measure of 95AÂ °C for 30 s, tempering temp between gradient of 56-62AÂ °C depending on primer type for 15 s, elongation for 30 s at 72Â °C. End rhythm with elongation for farther 7 min at 72Â °C. Cycle was repeated 30 times. 2 % Agarose gel ( Biosciences, Dun Laoghaire, Ireland ) pre-stained with SYBR Safea„? ( Molecular Probes, Eugene, USA ) cataphoresis was run in Tris ethanoate EDTA ( TAE ) . ( Sigma Aldricha„? Inc, Saint Louis, USA ) with Amplisize ( Biorad, Hercules, USA ) as a molecular marker runing from 50 to 2000 bp. The gel was examined in G-BOX ( Syngenes, Cambridge, UK ) under UV visible radiation. Recovery of E coli in the presence of an unreal nutrient environment Innoculum was prepared with pre-culture at the exponential stage when the concentration was 108cfu/ml. 100AÂ µl was pipetted onto chromium steel steel vouchers incorporating different concentrations of unreal nutrient environment ( high, medium or low concentrations ) . After allocated clip ( 0 min, 30 min, 60 min ) vouchers were swabbed at 90Â °angle. Swabs were cut into SETS ( Roche Applied Science ) and centrifuged for 10 min at 6000g. Pellet was re-suspended with 150AÂ µl toller solution leting 50AÂ µl for EMA intervention and 50AÂ µl for home base numeration. Preparation of Propidium monoazide ( PMA ) PMA dissolved in 20 % DMSO to obtain a stock concentration of 20nM and stored at -20Â °C off from the visible radiation. 1.25AÂ µl PMA solution added to 500AÂ µl of civilization aliquots to give a concluding concentration of 50nM following the incubation period of 5minutes in the dark with occasional commixture to let the PMA to perforate the dead cells and to adhere to the DNA. Samples are so put in ice and placed 20cm from 500W halogen visible radiation beginning for 15minutes. Samples centrifuged at 10,000g for 10 proceedingss. Samples washed with NaCl ( ) and MilliQ H2O ( ) in order to take the inactivated PMA. Bibliography. Angelotti R, Foter M.J, Busch K.A, Lewis K.H ( 1958 ) . A comparative rating of methods for finding the bacterial taint on surfaces Public Health Report 79 ( 11 ) pp 1021-1024 available: PubMed database [ accessed 10 March 2010 ] Astrographics ( 2002 ) Escherichia coli bacteria [ image online ] , available: hypertext transfer protocol: //www.astrographics.com/GalleryPrintsIndex/GP2144.html [ assessed 10 March ] Becker, B. , Weiss, C. , Holzapfel, W.H ( 2008 ) An rating of the usage of three phenotypic trial systems for biochemical designation of Enterobacteriacea and Pseudomonadacea Food Control 20 ( 9 ) available: Science Direct [ accessed 13 Feb 2010 ] Bej, A.K. , Steffan, R.J. , DiCesare, J. , Haff, L. , Atlas, R.M. , ( 1990 ) Detection of coliform bacteriums in H2O by polymerase concatenation reaction and cistron investigations. Applied Environment Microbiology 56 pp 307-314 Biomerieux Industry ( 2010 ) APIAÂ ®ID32E [ online ] available: hypertext transfer protocol: //www.biomerieux-industry.com/servlet/srt/bio/industry-microbiology/dynPage? open=NDY_IND_FDA_PRD A ; doc=NDY_FDA_PRD_G_PRD_NDY_17 A ; pubparams.sform=0 A ; lang=en [ accessed 19 March 2010 ] Bahrani- Mougeot F.K. , Paster, B.J. , Coleman, S. , Ashar, J. , Knost, S. , Sautter, R.L and Lockhart, P.B ( 2008 ) Designation of unwritten bacteriums in blood civilizations by conventional versus molecular methods Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology and Endodontology 105 ( 6 ) pp 720-724. Available: Science Direct [ accessed 11 March 2010 ] Copan Italia ( 2010 ) Why flocked swabs are superior to fibre cloaked swabs and froth swabs and how they can better infective disease nosologies , [ online ] , available: hypertext transfer protocol: //www.mls.be/nieuwsbrieven/css/Why-Flocked-Swabs-are-Superior-to-Fiber-and-Foam.pdf [ accessed 30 Feb 2010 ] Denton, M ( 2007 ) Enterobacteriaceae International Journal of Antimicrobial Agents 29 ( 3 ) available: Science Direct [ accessed 24 Feb 2010 ] Drudy D, O Rourke M, Murphy M, Mullane N.R, Kelly L, Fischer M, Sanjaq S, Wall P, OMahony M, Whyte P, Fanning S ( 2006 ) Characterisation of a aggregation of Enterbacter sakazakii isolates from environmental and nutrient beginnings International Journal of Food Microbiology 110 ( 2 ) pp 127-134 available: Science Direct database [ accessed 18 March 2010 ] Food Market Exchange ( 2001 ) HACCP Hazard Analysis Critical Control Point [ online ] available: hypertext transfer protocol: //www.foodmarketexchange.com/datacenter/laws/detail/dc_lr_reference_haccp [ accessed 17 Feb 2010 ] Galani I, Rekatsina P.D, Hatzaki D, Plachouras D, Souli M, Giamarellou H ( 2007 ) Evaluation of different research lab trials for the sensing of metalo-?-lactamase production in Enterobacteriaeae , Journal of Antimicrobial Chemotherapy 61 pp 548-553 Grant, M.A. , Weagent, S.D. , Feng, P ( 2001 ) Glutamate decarboxylase cistrons as a pre-screening marker for sensing of Escherichia coli groups Applied Environment Microbiology 67 pp 3110-3114 Griffith C.J, Davidson C.A, Peters, A.C and Fielding, L.M ( 1997 ) Towards a strategic cleansing assessment programme: hygiene monitoring and ATP luminometry, an options assessment Food Science Technology Today 11, pp 15-24. Hall L.B and Hartnett M.J ( 1964 ) Measurement of bacterial taint on surfaces in infirmaries Public Health Report 79 ( 11 ) pp 1021-1024, available: PubMed database [ accessed 24 March 2010 ] Horachova, K. , Mlejnkova, H. , Menjnek, P. , ( 2006 ) Direct sensing of bacterial fecal indexs in H2O samples utilizing PCR Water Science Technology 54 pp 135-140 Huang M.M, Arnheim N, Goodman M.F ( 1992 ) Extension of base mispairs byTaqDNApolymerase: deductions for individual nucleotide favoritism in PCR Nucleic Acids Research 20 ( 17 ) pp 4567-4573 Iqbal, S. , Robinson, J. , Deer, D. , Saunders, J.R. , Edwards, C. , Porter, J. , ( 1997 ) , Efficiency of the polymerase concatenation reaction elaboration of the uid cistron for sensing of Escherichia coli in contaminated H2O Lett Applied Microbiology 24 pp 498-502 Janda, J.M and Abbott, S.L ( 2001 ) Bacterial Designation for Publication: When is Enough, Enough? Journal of Clinical Microbiology 40 ( 6 ) pp 1887- 1891 Juck, D. , Ingram, J. , Prevost, M. , Coallier, J. , Greer, C ( 1996 ) Nested PCR protocol for the rapid sensing of Escherichia coli in drinkable H2O , Canadian Journal of Microbiology 42 862-866 Kang D, Eifert J.D, Williams R.C ( 2007 ) Evaluation of Quantitative Recovery Methods of Listeria monocytogenes Applied to Stainless Steel Journal of AOAC International 90 ( 3 ) Kenyon College ( 2010 ) , PCR sum-up of technique [ image online ] , available: hypertext transfer protocol: //biology.kenyon.edu/courses/biol114/Chap08/Chapter_08a.html [ accessed 20 March 2010 ] Kenyon College ( 2010 ) PCR sum-up of technique [ image online ] , available: hypertext transfer protocol: //biology.kenyon.edu/courses/biol114/Chap08/Chapter_08a.html [ accessed 20 March 2010 ] Khan, I.U.H. , Gannon, V. , Kent, R. , Koning, W. , Lapen, D.R. , Miller, J. , Neumann, N. , Phillips, R. , Robertson, W. , Topp, E. , Bochove, E. , Edge, T.A ( 2007 ) Development of rapid quantitative PCR check for direct sensing and quantification of culturable and non- culturable Escherichia coli from agiculture water partings Journal of Microbial Methods 67 pp 480-488 available: Science Direct [ assessed 13 March 2010 ] Kubista, M. , Andrade, J.M. , Bengtsson, M. , Forootan, A. , Jonak, J. , Lind, K. , Sindelka, R. , Sjoback, R. , Sjogreen, B. , Strombom, L. , Stahlerg, A. , Zoric, N. , ( 2006 ) The existent clip polymerase concatenation reaction Molecular Aspects of Medicine 27 pp95-125 available: Science Direct [ accessed 11 March 2010 ] .REVIEW Louie, M. , Louie, L and Simor, A. , E. ( 2000 ) . The function of DNA elaboration engineering in the diagnosing of infective diseases Canadian Medical Association Journal 163 ( 3 ) , pp 301-305 Mc Pherson, M. J. , Hames B. D, and Taylor, G. , R. , ( 1995 ) , PCR 2: A Practical Approach Oxford University Press, New York Microbiological hazard appraisal series 10 ( 2006 ) Enterobacter sakazakii and Salmonella in powdery baby expression, Google Books [ online ] , available: hypertext transfer protocol: //books.google.com/books? id=iHZSx2Wfe7EC A ; pg=PA76 A ; dq=enterobacteriaceae+in+food A ; as_brr=1 A ; cd=1 # v=onepage A ; q=enterobacteriaceae % 20in % 20food A ; f=false [ assessed 9 March 2010 ] Mossel D.A, Stryijk C.B ( 1995 ) Escherichia coli, other Enterobacteriaceae and extra indexs as markers of microbiologic quality of nutrient: advantages and disadvantages , Microbiologica 11 ( 1 ) pp 75-90. Available: Medline [ accessed 24 Feb 2010 ] Moore and Griffith ( 2002 ) Factors act uponing recovery of micro-organisms from surfaces by the usage of traditional hygiene swobing , Dairy, Food and Environmental Sanitation 22 ( 6 ) pp 410-421 Mueller, S.A. , Anderson, J.E and Byung, K ( 2009 ) Comparison of Plate counts, Petrifilm, Dipslides and Adenosine Triphosphate Bioluminescence for supervising bacteriums in chilling H2O armored combat vehicles , Water Environmental Research 81 ( 4 ) available: Wilson web [ accessed 24 March 2010 ] Nygren, J. , Svanvik, N. , Kubista, M. , ( 1998 ) The interaction between the fluorescent dye thiazole orange and DNA Biopolymers 46 pp 39-51 Ortega, M.P. , Hagiwara, T. , Watanabe, H. , Sakiyama, T. ( 2009 ) Adhesion behavior and removability of Escherichia coli on chromium steel steel surface Food Control 21 ( 4 ) pp 573-578 available: Science Direct [ accessed 13 March 2010 ] Reilly W.J. , Forbes, G.I. , Sharp, J.C.M. , Oboegbulem, S.I. , Collier, P.W and Paterson, G.M ( 1988 ) Poultry- Borne Salmonellosis in Scotland , Epidermiology and Infection 101 ( 1 ) pp 115-122 Rose, R.E. , Geldreich, E and Litsky, W ( 1974 ) Improved membrane filter method for fecal coliform analysis , Applied Microbiology 70 ( 9 ) pp 5692 5694. Roche PCR Applications Manual ( 2006 ) 3rd ed. , Germany: Fanz and Neumayer Rosrak D.B, Colwell R.R ( 1987 ) Survival schemes of bacteriums in the natural environment Microbial Rev 51 pp 365-379. Tsen, H.Y. , Lin, C.K. , Chi, W.R. , ( 1998 ) Development and usage of 16S rRNA cistron targeted PCR primers for the designation of Escherichia coli cells in H2O Journal of Applied Microbiology 85 pp 554- 560 Van Acker, J. , De Smet, I. , Muyldermans, G. , Bougatef, A. , Naessens, A. , Lauwer, S. ( 2000 ) Outbreak of Necrotizing Enterocolitis Associated with Enterobacter sakazakii in Powered Milk Formula , Journal of Clinical Microbiology 39 ( 1 ) pp 293-297 Wook Oh, S and Kang, D.H ( 2004 ) , Fluorogenic selective and differential medium for isolation of Enterobacter sakazakii , Applied and Environmental Microbiology, 70 ( 9 ) pp 5692-5694. Yang I, Kim Y H, Byun J.Y, Park S.R ( 2005 ) Use of manifold polymerase concatenation reactions to bespeak the truth of theannealing temperature of thermic cycling Analytic Biochemistry 338 ( 2 ) available: Science Direct [ assessed 10 March 2010 ]

Middle and Adolescence Development Essay Example | Topics and Well Written Essays - 500 words

Middle and Adolescence Development - Essay Example Peer relations are related to the formation of friendly group. The number of friends during this age is greater than any other age. This formulation is also similar to Maslow’s need for belongingness. The middle age peer relation concerns for the communal needs of acceptance by peers and avoidance by rejection. These communal needs include, affection, intimacy companionship, support etc.(Buhrmester, 1996). The adolescent shows increased influence of peer group than a middle childhood. During the transition period, the children usually reject old friends and come to new relations. Girls are more likely to accept new friends than boys. The middle childhood friendship is based on easiness to handle the friends. But in adolescence the relation is based on commonality. Peer rejection is painful during adolescence more than middle childhood. Thus though the emotional relations he slowly learns that the previously believed things are wrong The adolescent picks up the habit and social qualities of his companion. Peers influence his interests, attitude and values. The social behavior of an adolescent is controlled by the peer group. During this time the peer relation inculcates the sense of loyalty, sympathetic attitude and willingness to obey the social rules and regulation.

Database application, Planning, Design, and Implementation Assignment

Database application, Planning, Design, and Implementation - Assignment Example 273). To build huge groups of data functional, individuals and organizations make use of computers and effiecient data management systems. Similar to a warehouse, a database is a storage area for group of similar and associated data or facts. On the other hand, a database management system (DBMS) is software tool that facilitates multiple users to store, retrieve, and perform operations on data or facts into functional information (Norton, 2001, p. 272). The database design and development starts with the analysis of the system. In our database for home we will analyze the daily working routines and access the main aspects that can be documented and digitalized. For this purpose will conduct a detailed analysis for the overall working and activities performed in the house, for instance, we need a system that can document and manage the daily work plan, house budget, requirement management, indoor and outdoor activities. The databases system for the house can manage the daily work plan, record activities, handle house budget and specially the food menu. We can also manage and handle our diet plan with this system and develop a balanced daily diet plan. The system will provide us details and comprehensive information for the daily diet plan. There are various players in this databases that can use and manage the database at home. Parents can develop a diet plan for their children and feed them according to that plan. This makes the overall handling of the children diet easier. The parents also plan their daily tasks and duties so that they can perform those jobs at time and effectively. The handling of budget plan can be done by wife or husband that feed and allocate the appropriate resources for the house monthly resource management. The player can interact with the system and each other directly. The system will be available to every user and they can view and mange the resource according to their desire. The each section will be

Construction Safety Coursework Example | Topics and Well Written Essays - 500 words

Construction Safety - Coursework Example OSHA guidelines in many states act as mere guidelines and not the law as construction accidents increase as time goes by. This has caused many states e.g. Massachusetts and Connecticut to have in place stricter guidelines that highly follow OSHA rules or supersede them. Furthermore, these states ensure that the OSHA rules are followed to the letter e.g. the 10 hr-OSHA training (Ireland, 2006). As it has been seen trenching is an area that requires huge attention as fatalities and injuries are alarmingly high. Trenching has many regulations as to safety of the workers but they are hardly followed by construction firms. The case of Robert Harrell in Texas and Martin Samaniego in California are a clear proof of how neglected OSHA guidelines are. Investigations to these cases revealed that little had been done to protect these excavators from caving in or collapsing of the trenches they were working in. These are just but two fatality cases in two dozens reported yearly in the United States. Of importance to note is that more than 1000 cases of collapsed trenches are reported annually with non-fatal injuries (Ireland, 2006). The biggest issue that concerns safety in trench-related constructions is lack of enforcement of laid down regulations or guidelines. It is sad to note that in 2004 inspections in such sites by OSHA officials proved this fact. Around 90 percent of the inspected trench sites had no protective systems in place exposing the workers to immense danger of fatalities or injuries in case of cave-ins or collapse (Ireland, 2006). The remedial action that has been in force for quite a long time is the fining system. This shows that this system has faults or loopholes that are being taken advantage of by the contractors. For this reason some firms e.g. Morrilton and Koontz Electric Co. are known to disregard OSHA rules and enforce stiffer ones in their constructions (Ireland, 2006). Although sloping,

Dollar Tree Case Study Example | Topics and Well Written Essays - 1750 words

Dollar Tree - Case Study Example As such, multiple branches are needed of any one retailer in order to truly realize profit on the scale that would sustain the viability of any company for any length of time. Dollar Tree has been able to become such a company, gradually acquiring other discount chains over the years, to now have a presence throughout the entire continental United States and Canada. This paper serves to explain some of the reasons behind their success, as well as providing a description of some future challenges on the horizon. Case Challenge 1 The first challenge facing Dollar Tree rests in the reality that the company’s initial growth was accomplished almost exclusively through acquisition. The question then becomes whether or not this will be an attractive option in the near future. The reality is that expansion through acquisition will likely be quite difficult in today’s economic climate. The company is already struggling to keep its pricing model in tact (all items at $1), and the cost of acquiring other companies will make this increasingly difficult. With the company now poised to pass the 5,000 location mark in the near future, the reality is that it does not need to continue to grow in the manner. Already being considered the industry leader, there are few chains that are in direct competition with it to begin with. If they desire to acquire even more discount dollar chains, it will likely only be in areas of the country where they do not already have an established presence. Case Challenge 2 Dollar Tree also faces the challenge moving forward of being able to continue to offer

Management Ethics inPepsiCo Essay Example | Topics and Well Written Essays - 2500 words

Management Ethics inPepsiCo - Essay Example The researcher states that in the modern world there has been a paradigm shift in the values of corporate codes of ethics. Ethical values are not only associated with the work culture of an organization, it also implies on external factors such as stakeholders and society. Professional code of ethics, on the other hand, is also an essential component that is required to be implemented in industries. Professional code of ethics is different from the corporate code of ethics as it has no influence on distinguished wrongdoing in organizations. Since business organizations have to pass through different stages in terms of control systems, management systems, and formal structures. There are some significant developments that are required to be emphasized for its smooth running. Implementation of corporate codes of business ethics plays very important role in the management sector because it not only increases the values and workability in the organization, it also helps to gain the inter est of the external stakeholders of the organizations. This paper focuses on the ethical cultures that are implemented by the PepsiCo along with the continuous support of the management that has helped to maintain the ethical values in the organization. There are several theories of ethics that can be implemented in the work culture of the organizations. First of all, Consequentialism states that the majority of action depends on the moral cost that the action brings in the organizations. According to the organizational policies, each and every employee is expected to practice good and moral behavior and action in the workplace. The ratio between right and wrong determines the moral and ethical values of organizations. According to the theory of morality, every action must be accountable to someone in an organization. For any wrong action or wrong behavior, the person involved must take responsibility. Morality also suggests that every person in the world should have the potential a nd motive to perform only good practices and take up the responsibility for their wrong actions. This kind of behavior in people can help in social engagement and reduce the tendency of conflicts. Organizations strongly implement such policies in their work culture in order to increase productivity.

Emotional intellegince Research Paper Example | Topics and Well Written Essays - 750 words

Emotional intellegince - Research Paper Example Human capital plays pivotal role in business organizations and in their success. In today’s fiercely competitive business contexts, human capital and effectively managing this high-valued resource have become major corporate strategies that affect competitive advantage (Hall, 2008). Human capital is the sum total of knowledge, skills, talents, experience, wisdom and other personal as well as professional qualities that people in the organization possess and utilize for the organization’s purposes. HR roles and functions have been evolving tremendous changes from being fundamentally administrative to making strategic decisions regarding choosing right talents for right tasks. Jarrel (2012) emphasized that focusing on the emotional intelligence of people in the organization has become another change that the HR field has witnessed very recently. It was because those employees who showed high emotional intelligence have influenced others around them positively rather than negatively. Why emotional intelligence matters in the workplace is because the way people affect others in the same workplace is an important matter to affect the effectiveness of leadership, teamwork, collaboration, knowledge sharing, organizational learning and so on. For instance, transformational or charismatic leaders are those who influence their subordinates by identifying their needs and taking positive ways to meet their requirements. Stough, Saklofske and Parker (2009) are of the view that leadership effectiveness is closely linked to the levels of emotional intelligence of the leader. With a view to achieve highest level of emotional intelligence in the workplace, human resource management adopts selective hiring and training and development program to ensure that their workforce would demonstrate EI competencies. By using Hendrie Weisinger’s Emotional Intelligence assessment tool, I found that my overall EI level was above the average, with a point of 84. The levels of self

Dollar Tree Case Study Example | Topics and Well Written Essays - 1750 words

Dollar Tree - Case Study Example As such, multiple branches are needed of any one retailer in order to truly realize profit on the scale that would sustain the viability of any company for any length of time. Dollar Tree has been able to become such a company, gradually acquiring other discount chains over the years, to now have a presence throughout the entire continental United States and Canada. This paper serves to explain some of the reasons behind their success, as well as providing a description of some future challenges on the horizon. Case Challenge 1 The first challenge facing Dollar Tree rests in the reality that the company’s initial growth was accomplished almost exclusively through acquisition. The question then becomes whether or not this will be an attractive option in the near future. The reality is that expansion through acquisition will likely be quite difficult in today’s economic climate. The company is already struggling to keep its pricing model in tact (all items at $1), and the cost of acquiring other companies will make this increasingly difficult. With the company now poised to pass the 5,000 location mark in the near future, the reality is that it does not need to continue to grow in the manner. Already being considered the industry leader, there are few chains that are in direct competition with it to begin with. If they desire to acquire even more discount dollar chains, it will likely only be in areas of the country where they do not already have an established presence. Case Challenge 2 Dollar Tree also faces the challenge moving forward of being able to continue to offer

Emotional intellegince Research Paper Example | Topics and Well Written Essays - 750 words

Emotional intellegince - Research Paper Example Human capital plays pivotal role in business organizations and in their success. In today’s fiercely competitive business contexts, human capital and effectively managing this high-valued resource have become major corporate strategies that affect competitive advantage (Hall, 2008). Human capital is the sum total of knowledge, skills, talents, experience, wisdom and other personal as well as professional qualities that people in the organization possess and utilize for the organization’s purposes. HR roles and functions have been evolving tremendous changes from being fundamentally administrative to making strategic decisions regarding choosing right talents for right tasks. Jarrel (2012) emphasized that focusing on the emotional intelligence of people in the organization has become another change that the HR field has witnessed very recently. It was because those employees who showed high emotional intelligence have influenced others around them positively rather than negatively. Why emotional intelligence matters in the workplace is because the way people affect others in the same workplace is an important matter to affect the effectiveness of leadership, teamwork, collaboration, knowledge sharing, organizational learning and so on. For instance, transformational or charismatic leaders are those who influence their subordinates by identifying their needs and taking positive ways to meet their requirements. Stough, Saklofske and Parker (2009) are of the view that leadership effectiveness is closely linked to the levels of emotional intelligence of the leader. With a view to achieve highest level of emotional intelligence in the workplace, human resource management adopts selective hiring and training and development program to ensure that their workforce would demonstrate EI competencies. By using Hendrie Weisinger’s Emotional Intelligence assessment tool, I found that my overall EI level was above the average, with a point of 84. The levels of self

Italian Unification between 1815-1848 Essay Example for Free

Italian Unification between 1815-1848 Essay To what extent is it true to say that there was absolutely no movement or prospect of Italian Unification between 1815-1848? Between the years 1818 and 1848 there were many revolutions in Italy starting in the year 1821. The statement above states ‘absolutely no movement or prospect,’ therefore I strongly disagree with this due to the fact that there must have been some movement to achieve what Italy were finally able to. The following essay will give different points on the statement. In my opinion, I do not agree with the statement, one main reason being there were enough people in Italy that wanted it to be unified and that fought for what they believed in. For example the secret societies. During the times Italy was under the ruling of Metternich, many secret societies were formed, with passwords, mutual protection and sometimes even semi-religious rituals. The Carbonari, the most well known society and so consequently the most important. There were approximately 60,000 members involved, and it was particularly active in South Italy, especially in Naples. There aims were relatively mild, in Piedmont and Naples for example they hoped to establish a constitutional monarchy. It is already possible to see that there was some movement in Italy from secret societies that were hoping for Italian Unification. Another reason I disagree with the statement is due to Italy being under the ruling of Metternich. Although it was difficult living under the Austrians, and they were clearly putting an obstacle in the way of unification, I believe that it was actually a large contribution to the happening of unification. For example, due to Metternich trying to belittle the country by separating it into small constituencies, it made the Italian public want to fight back, and therefore as a consequence start revolutions. Three major revolutions occurred in Italy in the years, 1820-21, 1831-32, 1848-49. I believe this proves that things were being done to help unification rather than there being ‘absolutely no movement’. Additionally there is Giuseppe Mazzini, who is said to be a key figure in the history of Italian Unification. Mazzini was born in 1805, he had one overriding aim being ‘the brotherhood of people’. He believed in the equality of human beings and of races. In 1831, Mazzini founded ‘Young Italy’, this being Italy’s first real political party. Mazzini described the party as, ‘a brotherhood of Italians who believe in a law offreemen and equals.’ Those in the party had to swear to commit themselves to make Italy ‘one free, independent, republican nation.’ Mazzini’s ideas were incredibly radical for that period of time, for example, his ideal was that the people should rise up agains their oppressors, there should be unification ‘from below.’ Eventually there was unification however it came more from above. Yet Mazzini proves once again that there was movement and prospect towards Italian unification, Young Italy being another example. Although Mazzini may not have been successful at that precise moment, we can now see that unification was actually reached. Linking to my previous point, it has been proven that Mazzini was not only famous for his radical beliefs but also for converting people to the cause. This point firstly proves that some movement was being made in the form of attracting people to the challenge that was Italian unification, but furthermore, proves further movement in the fact that there must have been an incredible number of supporters that were in favour of unification, and therefore plans must have been made to try and succeed. Finally, by seeing that Italian Unification was attained eventually, we can ultimately say that there must have been enough movement and enough prospect for the aim to be successful. For these reasons, i disagree with the statement ‘To what extent is it true to say that there was absolutely no movement or prospect of Italian Unification between 1815-1848?’ On the other hand, there are many events from this period of time that may agree with the statement previously specified. For example, after the French revolution, Metternich reinstated the previous monarchs of each constituency. Most of the monarchs were reactionary and therefore there was a large obstacle blocking the path to unification. Being such a large predicament, one can assume that there was ‘absolutely no movement.’ In addition, the lack of progress that went into uniting the country through language may have been seen as lacking and therefore lead ones opinions to believe once again no progress was being made. Furthermore, even with the countless revolutions that were attempted not one succeeded permanently. So, although this particular example goes against there being absolutely no movement, due to the fact there was clearly movement in the form of revolutions, it does agree however with there being no prospect of unification, seeing as every individual revolution from each specific country failed inevitably. This was in consequence of the Austrians suppressing the revolutions and then re inviting the previous leaders to come and transform the constituence to the way it had previously been. Following this, it is now possible to appreciate the separation between the North and South of Italy. The Northern half containing the wealthier half of the population, whilst the Southern half being populated with the poorer families. Due to this large partition, it is hard to see any prospect in Italian Unification and therefore one can easily agree with the statement above. In relation to the previous point is the division of the Apennine Mountains. In those times, the Apennine Mountains were practically the back bone of Italy, until it was partitioned into North-East and South-West by Metternich. It is understood that without a back bone, a body would be unable to stand, hence the fact that without the Apennine Mountains it would be incredibly challenging for the population of Italy to achieve the prospect of unification. Overall, one can see that there are many justifications for both sides of this argument. Although from this essay it seems the statement is in fact true, I strongly disagree. Understanding that there may be proof to support the statement, at the end of the day Italian Unification was achieved, and therefore it is impossible to say that there was ‘absolutely no movement’ because the aim was fulfilled and therefore some movement must have taken place. In conclusion, I disagree with the statement ‘to what extent is it true to say that there was absolutely no movement or prospect of Italian Unification between 1815-1848’ because this declaration clearly states that there was ‘absolutely no movement’ towards Italian Unification between those years, yet unification was completed, thus whether there was a lot of movement, or in some case a little, there was undoubtedly more than none, and for this reason I forcefully disagree with the statement.